jimhester · January 8, 2018 14:50 · Nov 20, 2013 · May 16, 2013 · Aug 20, 2012 · Jul 31, 2012
diff --git a/fasta2.py b/fasta2.py
@@ -0,0 +1,19 @@
+#!/usr/bin/env python
+
+import os,sys
+
+f = open(sys.argv[1],'rU')
+header = f.readline()
+header = header.rstrip(os.linesep)
+sequences=[]
+for line in f:
+  line = line.rstrip('\n')
+  if(line[0] == '>'):
+    header = header[1:]
+    header = line
+    print header, len("".join(sequences))
+    sequences = []
+  else:
+    sequences.append(line)
+
+print header, len("".join(sequences))
diff --git a/append.pl b/append.pl
@@ -9,15 +9,10 @@
   chomp $line;
   if($line =~ /^>/){
     $header = substr($header,1);
-    ##########
-    #Process Record
-    ##########
     $header = $line;
     $sequence = ''
+    print "$sequence\tlength($sequence)\n";
   } else {
     $sequence .= $line;
   }
 }
-##########
-#Process Last Record
-##########
diff --git a/fasta-bioperl.pl b/fasta-bioperl.pl
@@ -6,8 +6,5 @@
 my $in = Bio::SeqIO->new(-file => shift, '-format' => 'Fasta');
 
 while(my $rec = $in->next_seq() ){
-  ##########
-  #Process record
-  ##########
   print join(" ",$rec->display_id,$rec->length)."\n";
 }
diff --git a/fasta-bioperl2.pl b/fasta-bioperl2.pl
@@ -6,8 +6,5 @@
 my $in = Bio::SeqIO->new(-file => shift, -format => 'Fasta', -alphabet => 'dna');
 
 while(my $rec = $in->next_seq() ){
-  ##########
-  #Process record
-  ##########
   print join(" ",$rec->display_id,$rec->length)."\n";
 }
diff --git a/fasta-biopython.py b/fasta-biopython.py
@@ -4,7 +4,4 @@
 from Bio import SeqIO
 
 for record in SeqIO.parse(sys.argv[1],'fasta'):
-  ##########
-  #Process record
-  ##########
   print record.id, len(record)
diff --git a/fasta-bioruby.rb b/fasta-bioruby.rb
@@ -4,8 +4,5 @@
 
 ff = Bio::FlatFile.new(Bio::FastaFormat,ARGF)
 ff.each_entry do |record|
-  ##########
-  #Process record
-  ##########
   puts [record.definition, record.nalen.to_s ].join(" ")
-end
+end
diff --git a/fasta.go b/fasta.go
@@ -0,0 +1,52 @@
+package main
+
+import (
+  "bufio"
+  "io"
+  "fmt"
+  "os"
+  "strings"
+)
+
+type fasta struct {
+  header string
+  sequence string
+}
+
+func NewFastxReader(f io.Reader) *FastxReader {
+        return &FastxReader{
+                r:         bufio.NewReader(f),
+        }
+}
+type FastxReader struct {
+  r   *bufio.Reader
+}
+func (r *FastxReader) next_seq() (record fasta, err error) {
+  var str string
+  if str, err = r.r.ReadString('>'); err == nil {
+     if str, err = r.r.ReadString('>'); err == nil {
+       split_result := strings.SplitN(str, "\n", 2)
+       record.header = split_result[0]
+       //remove newlines and trailing >
+       record.sequence = chomp(strings.Replace(split_result[1], "\n", "", -1), ">")
+     }
+  }
+  return record, err
+}
+
+//remove last char in a string if that char is the delim
+func chomp(s string, delim string) string {
+   if s[len(s)-1] == delim[0] {
+    return s[0:len(s)-1]
+  }
+  return s
+}
+
+func main() {
+  file, _ := os.Open(os.Args[1])
+  fastx = NewFastxReader(file)
+  for rec, err := fastx.next_seq(); err == nil; {
+    fmt.Println(rec.header, "\t", len(rec.sequence))
+    rec, err = fastx.next_seq();
+  }
+}
diff --git a/fasta.pl b/fasta.pl
@@ -10,7 +10,5 @@
   my $header = substr($record,0,$newline_loc);
   my $sequence = substr($record,$newline_loc+1);
   $sequence =~ tr/\n//d;
-  ##########
-  #Process record
-  ##########
-}
+  print "$sequence\t" . length($sequence) . "\n";
+}
diff --git a/fasta.py b/fasta.py
@@ -10,15 +10,10 @@
   line = line.rstrip('\n')
   if(line[0] == '>'):
     header = header[1:]
-    ##########
-    #Process Record
-    ##########
     header = line
+    print header, len(sequence)
     sequence = ''
   else:
     sequence += line
 
-##########
-#Process Last Record
-##########
-
+print header, len(sequence)
diff --git a/fasta.rb b/fasta.rb
@@ -8,7 +8,5 @@
   header = rec[0..nl-1]
   seq = rec[nl+1..-1]
   seq.gsub!(/\n/,'')
-  ##########
-  #Process record
-  ##########
-end
+  puts [header, seq.length].join(" ")
+end
diff --git a/fasta-bioperl2.pl b/fasta-bioperl2.pl
@@ -3,7 +3,7 @@
 use warnings;use strict;
 use Bio::SeqIO;
 
-my $in = Bio::SeqIO->new(-file => shift, -format => 'Fasta' -alphabet => 'dna');
+my $in = Bio::SeqIO->new(-file => shift, -format => 'Fasta', -alphabet => 'dna');
 
 while(my $rec = $in->next_seq() ){
   ##########

diff --git a/fasta.pl b/fasta.pl
@@ -1,8 +1,8 @@
 #!/usr/bin/env perl
 
-use warnings;use strict;use English;
+use warnings;use strict;
 
-local $RS = ">";
+local $/ = ">";
 my $first = <>;
 while(my $record = <>){
   chomp $record;

diff --git a/fasta.py b/fasta.py
@@ -2,7 +2,7 @@
 
 import os,sys
 
-f = open(sys.argv[1],'r')
+f = open(sys.argv[1],'rU')
 header = f.readline()
 header = header.rstrip(os.linesep)
 sequence=''

diff --git a/fasta.py b/fasta.py
@@ -17,3 +17,8 @@
     sequence = ''
   else:
     sequence += line
+
+##########
+#Process Last Record
+##########
+
diff --git a/fasta-bioperl2.pl b/fasta-bioperl2.pl
@@ -0,0 +1,13 @@
+#!/usr/bin/env perl
+
+use warnings;use strict;
+use Bio::SeqIO;
+
+my $in = Bio::SeqIO->new(-file => shift, -format => 'Fasta' -alphabet => 'dna');
+
+while(my $rec = $in->next_seq() ){
+  ##########
+  #Process record
+  ##########
+  print join(" ",$rec->display_id,$rec->length)."\n";
+}
diff --git a/fasta-biopython.rb → fasta-biopython.py b/fasta-biopython.rb → fasta-biopython.py
diff --git a/fasta-bioperl.pl b/fasta-bioperl.pl
@@ -0,0 +1,13 @@
+#!/usr/bin/env perl
+
+use warnings;use strict;
+use Bio::SeqIO;
+
+my $in = Bio::SeqIO->new(-file => shift, '-format' => 'Fasta');
+
+while(my $rec = $in->next_seq() ){
+  ##########
+  #Process record
+  ##########
+  print join(" ",$rec->display_id,$rec->length)."\n";
+}
diff --git a/fasta-biopython.rb b/fasta-biopython.rb
@@ -0,0 +1,10 @@
+#!/usr/bin/env python
+
+import sys
+from Bio import SeqIO
+
+for record in SeqIO.parse(sys.argv[1],'fasta'):
+  ##########
+  #Process record
+  ##########
+  print record.id, len(record)
diff --git a/fasta-bioruby.rb b/fasta-bioruby.rb
@@ -0,0 +1,11 @@
+#!/usr/bin/env ruby
+
+require 'bio'
+
+ff = Bio::FlatFile.new(Bio::FastaFormat,ARGF)
+ff.each_entry do |record|
+  ##########
+  #Process record
+  ##########
+  puts [record.definition, record.nalen.to_s ].join(" ")
+end
diff --git a/fasta.py b/fasta.py
@@ -1,19 +1,19 @@
 #!/usr/bin/env python
 
-import os,sys$
+import os,sys
 
-f = open(sys.argv[1],'r')$
-header = f.readline()$
-header = header.rstrip(os.linesep)$
-sequence=''$
-for line in f:$
-  line = line.rstrip('\n')$
-  if(line[0] == '>'):$
-    header = header[1:]$
-    ##########$
-    #Process Record$
-    ##########$
-    header = line$
-    sequence = ''$
-  else:$
-    sequence += line$
+f = open(sys.argv[1],'r')
+header = f.readline()
+header = header.rstrip(os.linesep)
+sequence=''
+for line in f:
+  line = line.rstrip('\n')
+  if(line[0] == '>'):
+    header = header[1:]
+    ##########
+    #Process Record
+    ##########
+    header = line
+    sequence = ''
+  else:
+    sequence += line
diff --git a/fasta.rb b/fasta.rb
@@ -1,14 +1,14 @@
 #!/usr/bin/env ruby
 
-$/ = ">"$
-ARGF.gets$
-while rec = ARGF.gets$
-  rec.chomp!$
-  nl = rec.index("\n")$
-  header = rec[0..nl-1]$
-  seq = rec[nl+1..-1]$
-  seq.gsub!(/\n/,'')$
+$/ = ">"
+ARGF.gets
+while rec = ARGF.gets
+  rec.chomp!
+  nl = rec.index("\n")
+  header = rec[0..nl-1]
+  seq = rec[nl+1..-1]
+  seq.gsub!(/\n/,'')
   ##########
   #Process record
   ##########
-end$
+end
diff --git a/append.pl b/append.pl
@@ -10,7 +10,7 @@
   if($line =~ /^>/){
     $header = substr($header,1);
     ##########
-    #Process Recordn
+    #Process Record
     ##########
     $header = $line;
     $sequence = ''

diff --git a/append.pl b/append.pl
@@ -0,0 +1,23 @@
+#!/usr/bin/env perl
+
+use warnings;use strict;
+
+my ($header,$sequence);
+$header = <>;
+chomp $header;
+while(my $line = <>){
+  chomp $line;
+  if($line =~ /^>/){
+    $header = substr($header,1);
+    ##########
+    #Process Recordn
+    ##########
+    $header = $line;
+    $sequence = ''
+  } else {
+    $sequence .= $line;
+  }
+}
+##########
+#Process Last Record
+##########
diff --git a/fasta.pl b/fasta.pl
@@ -0,0 +1,16 @@
+#!/usr/bin/env perl
+
+use warnings;use strict;use English;
+
+local $RS = ">";
+my $first = <>;
+while(my $record = <>){
+  chomp $record;
+  my $newline_loc = index($record,"\n");
+  my $header = substr($record,0,$newline_loc);
+  my $sequence = substr($record,$newline_loc+1);
+  $sequence =~ tr/\n//d;
+  ##########
+  #Process record
+  ##########
+}
diff --git a/fasta.py b/fasta.py
@@ -0,0 +1,19 @@
+#!/usr/bin/env python
+
+import os,sys$
+
+f = open(sys.argv[1],'r')$
+header = f.readline()$
+header = header.rstrip(os.linesep)$
+sequence=''$
+for line in f:$
+  line = line.rstrip('\n')$
+  if(line[0] == '>'):$
+    header = header[1:]$
+    ##########$
+    #Process Record$
+    ##########$
+    header = line$
+    sequence = ''$
+  else:$
+    sequence += line$
diff --git a/fasta.rb b/fasta.rb
@@ -0,0 +1,14 @@
+#!/usr/bin/env ruby
+
+$/ = ">"$
+ARGF.gets$
+while rec = ARGF.gets$
+  rec.chomp!$
+  nl = rec.index("\n")$
+  header = rec[0..nl-1]$
+  seq = rec[nl+1..-1]$
+  seq.gsub!(/\n/,'')$
+  ##########
+  #Process record
+  ##########
+end$
diff --git a/fasta_example.fa b/fasta_example.fa
@@ -0,0 +1,11 @@
+>chr1|this is a fasta header|example
+CCTAAACCCTGAACCCTAAACCCTAAACCCTGAACCCTAAACCCTGAACCCTGAACCCTAAACCCTGAACCCTAAACCTA
+AACCCTGAACCCTGAACCCTAAACCCTGAACCCTAAACCCTAAACCCTAAACCTAAACCCTGAACCCTAAACCTAAACCC
+TGAACCCTAAACCCTAAACCCTGAACCCTAAACCTAAACCCTGAACCCTAACCCCTGAACCCTAAACCCTGAACCCTAAA
+CCCTGAAACCTGAACCCTGAACCCTAAACCCTAAACCCTGAACCCTAAACCCTGAACCCTGAACCCTAAACCCTGAACCC
+>chr2|another record
+TAAACCCTGAACCCTAAACCCTAAACCCTGAACCCTAAACCTAAACCATGAACCCTAAACCCTGAACCCTAAACCCTAAA
+CCCTGAACCCTAAACCCTGAACCCTAAACCTAAACCCTAAACCCTGAACCCTAAACCTGAACCCTAAACCCCTAAACCTA
+AACCCTGAAACCTAAACCCTAAACCCTGAACCCTAAACCCTAAACCCTGAACCCTGAAACCCTGAACCCTAAACCATGAA
+CCCTGAACCCTAAACCCTAAACCCTAAACCCTGAACCCTGAACCCTAAACCTAAACCCTGAACCCTGAACCCTAAACCCT
+GAACCCTAAACCCTAAACCCTGAACCCTAAACCCTGAACCCTAAACCCTGAACCCTGAACCCTAAACCCTGAACCCTAAA