This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import data | |
#sequence = 'cgauggccuaaguuaaagcauccaagcguagauaauagugga' | |
''' | |
Functions defined here: | |
convertDNAtoRNA(sequence) | |
countNucleotides(sequence) | |
getLength(sequence) | |
sequenceIsValid(sequence) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
''' | |
Data file for bioinformatics research project | |
All of the following are genes were parsed for this project. | |
All are copied from NCBI's Nucleotide Database. Links are provided. | |
''' | |
'''GENES FROM CHROMOSOME 10 USED TO FIND CG CONTENT''' | |
#length 3618, http://www.ncbi.nlm.nih.gov/nuccore/XM_011539816.1 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
''' | |
Large Seven-Segment Display | |
Python Code for controlling display with a Raspberry Pi's GPIO | |
Written by Amanda on electrothoughts.wordpress.com, Aug 25, 2015 | |
Modify this code to your heart's content! | |
This code contains function definitions. To make your display work, | |
it's recommended that you run the code in the Python shell IDE as root, and execute | |
functions from there, for example enter the following in a terminal: |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
/* | |
Using an Arduino with a Power Relay | |
Parts used: | |
--ultrasonic sensor | |
--desk lamp | |
--Arduino Uno | |
--120v relay |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import time | |
j = 0 | |
pi = 0 | |
plusminus = True | |
start_time = time.time() | |
while True: | |
if j%2 == 1: | |
if plusminus == True: | |
pi += (1/j) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
''' | |
Tic Tac Toe -- Raspberry Pi GPIO -- v0.0 | |
Amanda on Electrothoughts -- March 2016 | |
--arcade game | |
--four-way keypad | |
--3x3 LED grid | |
--sound FX | |
--decent computer AI | |
--uses software PWM |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
//This sketch demonstrates how to interface with ultrasonic sensors using the Arduino and NewPing library | |
#include <NewPing.h> | |
int TRIGGER = 12; | |
int ECHO = 11; | |
//Declare a sonar object specifying the trigger and echo pins | |
NewPing sonar(TRIGGER, ECHO); |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
''' | |
Order of the Raspberry -- Amanda, Josiah, and Xavier | |
Group Project -- Raspberry Pi 2015-2016 | |
Melodies and Piezo Buzzers | |
See below for more details on the code. | |
Please use this code for whatever you want!! It can be improved in a lot of ways, | |
and can be used for many different circuit projects! | |
''' |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
''' | |
Experimental Probability Dice Simulator | |
This program serves to demonstrate how experimental probability gives | |
way to theoretical probability as the number of trials increases, using rolls | |
of a perfect, standard, cube-shaped die. In effect, it demonstrates that the | |
probability of rolling any number on a perfect die is: | |
lim x = 1/6 = 0.1666... | |
x -> infty |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
/* | |
* Analog Joystick Mouse Emulator with Arduino Micro | |
* | |
* This code turns a joystick into a computer mouse. | |
* | |
* Written by Amanda on Electrothoughts Jan 2016, with help from: | |
* - https://www.arduino.cc/en/Tutorial/JoystickMouseControl | |
* - book Exploring Arduino by Jeremy Blum: https://github.com/sciguy14/Exploring-Arduino/blob/master/Chapter%2006/mouse/mouse.ino | |
* | |
* For build instructions and background info visit www.electrothoughts.wordpress.com/2016/01/18/mouse-emulation-with-an-analog-joystick-and-arduino/ |
NewerOlder